Product Details

SNP ID: rs201012343
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:1771330 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTGAAGCCCTTCCTCTCGAAGCGCC[A/G]CACAATCTCGCCCACCAGCCGCCGC
Phenotype: MIM: 610886 MIM: 605431 MIM: 611994 MIM: 601817 MIM: 611659
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EME2 PubMed Links

Gene Details

Gene: EME2
Gene Name: essential meiotic structure-specific endonuclease subunit 2

There are no transcripts associated with this gene.

Gene: MAPK8IP3
Gene Name: mitogen-activated protein kinase 8 interacting protein 3

There are no transcripts associated with this gene.

Gene: MRPS34
Gene Name: mitochondrial ribosomal protein S34

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300900.1	338	Intron			NP_001287829.1
NM_023936.1	338	Intron			NP_076425.1
XM_017023595.1	338	Intron			XP_016879084.1

Gene: NME3
Gene Name: NME/NM23 nucleoside diphosphate kinase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002513.2	338	Missense Mutation	CGG,TGG	R43W	NP_002504.2
XM_005255332.4	338	Missense Mutation	CGG,TGG	R43W	XP_005255389.1
XM_011522503.2	338	Missense Mutation	CGG,TGG	R43W	XP_011520805.1
XM_011522504.2	338	Missense Mutation	CGG,TGG	R43W	XP_011520806.1

Gene: SPSB3
Gene Name: splA/ryanodine receptor domain and SOCS box containing 3

There are no transcripts associated with this gene.

View Full Product Details