Product Details

SNP ID: rs201950145
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:282503 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GATTGTCAGCGGCCTCAAGTGTCTG[C/T]ACCACACCTACCGCCGGGGCCTGCG
Phenotype: MIM: 602844 MIM: 603816 MIM: 608012 MIM: 603895
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ARHGDIG PubMed Links

Gene Details

Gene: ARHGDIG
Gene Name: Rho GDP dissociation inhibitor gamma

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001176.3	526	Missense Mutation	CAC,TAC	H151Y	NP_001167.2

Gene: AXIN1
Gene Name: axin 1

There are no transcripts associated with this gene.

Gene: PDIA2
Gene Name: protein disulfide isomerase family A member 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006849.2	526	Intron			NP_006840.2

Gene: RGS11
Gene Name: regulator of G-protein signaling 11

There are no transcripts associated with this gene.

View Full Product Details