Product Details

SNP ID: rs201620629
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:30086847 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGTTTCCTCTTCACACGGGCGTCTC[A/G]CTCCCTGGGGAACAGTGGTGGTGAT
Phenotype: MIM: 602035 MIM: 602427 MIM: 609724
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC101928595 PubMed Links

Gene Details

Gene: LOC101928595
Gene Name: uncharacterized LOC101928595

There are no transcripts associated with this gene.

Gene: PPP4C
Gene Name: protein phosphatase 4 catalytic subunit

There are no transcripts associated with this gene.

Gene: TBX6
Gene Name: T-box 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004608.3	929	Missense Mutation			NP_004599.2
XM_005255523.2	929	Nonsense Mutation			XP_005255580.1
XM_011545926.2	929	Nonsense Mutation			XP_011544228.1
XM_017023614.1	929	Nonsense Mutation			XP_016879103.1

Gene: YPEL3
Gene Name: yippee like 3

There are no transcripts associated with this gene.

View Full Product Details