Product Details

SNP ID: rs202070240
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:42841530 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TACATGACATGATCCTGAAAAATAT[C/T]GAGAAGATCAAACGGCCCCGGAGCA
Phenotype: MIM: 602268 MIM: 603735 MIM: 605129
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AOC2 PubMed Links

Gene Details

Gene: AOC2
Gene Name: amine oxidase, copper containing 2

There are no transcripts associated with this gene.

Gene: AOC3
Gene Name: amine oxidase, copper containing 3

There are no transcripts associated with this gene.

Gene: PSME3
Gene Name: proteasome activator subunit 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267045.1	1207	Silent Mutation	ATC,ATT	I250I	NP_001253974.1
NM_005789.3	1207	Silent Mutation	ATC,ATT	I239I	NP_005780.2
NM_176863.2	1207	Silent Mutation	ATC,ATT	I252I	NP_789839.1
XM_011524177.2	1207	Silent Mutation	ATC,ATT	I178I	XP_011522479.1

View Full Product Details