Product Details

SNP ID: rs202086475
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:32341240 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCAGAGGGAGTTTCTGCATTTGTG[C/T]CACTTGGGCTTCCGTCCTCACTGTC
Phenotype: MIM: 603428
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C17orf75 PubMed Links

Gene Details

Gene: C17orf75
Gene Name: chromosome 17 open reading frame 75

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022344.3	273	Missense Mutation			NP_071739.2
XM_005258022.3	273	Missense Mutation			XP_005258079.1
XM_017024940.1	273	UTR 5			XP_016880429.1
XM_017024941.1	273	UTR 5			XP_016880430.1

Gene: MIR632
Gene Name: microRNA 632

There are no transcripts associated with this gene.

Gene: ZNF207
Gene Name: zinc finger protein 207

There are no transcripts associated with this gene.

View Full Product Details