Product Details

SNP ID: rs200151509
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:58552087 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTTCATCTTCCTCATCACCCATGGC[A/G]TCATCAATGGCATCATTCATCATCT
Phenotype: MIM: 610893 MIM: 194550 MIM: 601742 MIM: 603173
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CHMP2A PubMed Links

Gene Details

Gene: CHMP2A
Gene Name: charged multivesicular body protein 2A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014453.3	1231	Silent Mutation	GAC,GAT	D149D	NP_055268.1
NM_198426.2	1231	Silent Mutation	GAC,GAT	D149D	NP_940818.1
XM_005258746.2	1231	Silent Mutation	GAC,GAT	D149D	XP_005258803.1
XM_005258747.3	1231	Silent Mutation	GAC,GAT	D149D	XP_005258804.1

Gene: MIR6807
Gene Name: microRNA 6807

There are no transcripts associated with this gene.

Gene: MZF1
Gene Name: myeloid zinc finger 1

There are no transcripts associated with this gene.

Gene: MZF1-AS1
Gene Name: MZF1 antisense RNA 1

There are no transcripts associated with this gene.

Gene: TRIM28
Gene Name: tripartite motif containing 28

There are no transcripts associated with this gene.

Gene: UBE2M
Gene Name: ubiquitin conjugating enzyme E2 M

There are no transcripts associated with this gene.

View Full Product Details