Product Details
- SNP ID
-
rs199595024
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:18386321 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCCGCGCAAGTTTCCCGGGACCCTC[A/C]GAGTTGCACTCCGAAGACTCCAGAT
- Phenotype
-
MIM: 605312
MIM: 607518
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
GDF15
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs6413435] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- GDF15
- Gene Name
- growth differentiation factor 15
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_004864.2 |
164 |
Silent Mutation |
TCA,TCC |
S44S |
NP_004855.2 |
- Gene
- LRRC25
- Gene Name
- leucine rich repeat containing 25
There are no transcripts associated with this gene.
- Gene
- MIR3189
- Gene Name
- microRNA 3189
There are no transcripts associated with this gene.
View Full Product Details