Product Details

SNP ID: rs200224355
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:58551708 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGTCTGCATCAGCATCAGCTAGGG[C/T]TGAGGCTGCGGCCTCTGCTTTTTTC
Phenotype: MIM: 610893 MIM: 601742 MIM: 603173
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CHMP2A PubMed Links

Gene Details

Gene: CHMP2A
Gene Name: charged multivesicular body protein 2A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014453.3	1523	Missense Mutation	ACC,GCC	T204A	NP_055268.1
NM_198426.2	1523	Missense Mutation	ACC,GCC	T204A	NP_940818.1
XM_005258746.2	1523	Missense Mutation	ACC,GCC	T247A	XP_005258803.1
XM_005258747.3	1523	Missense Mutation	ACC,GCC	T247A	XP_005258804.1

Gene: MIR6807
Gene Name: microRNA 6807

There are no transcripts associated with this gene.

Gene: MZF1-AS1
Gene Name: MZF1 antisense RNA 1

There are no transcripts associated with this gene.

Gene: TRIM28
Gene Name: tripartite motif containing 28

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005762.2	1523	Intron			NP_005753.1

Gene: UBE2M
Gene Name: ubiquitin conjugating enzyme E2 M

There are no transcripts associated with this gene.

Gene: ZBTB45
Gene Name: zinc finger and BTB domain containing 45

There are no transcripts associated with this gene.

View Full Product Details