Product Details
- SNP ID
-
rs201624630
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:13877385 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CCAATGCTGGAGCCGGTGTCAGCCC[C/T]GGAGCCGATGCCAGCGCCGGAGTCG
- Phenotype
-
MIM: 612746
MIM: 608229
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
C19orf57
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs567049270] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- C19orf57
- Gene Name
- chromosome 19 open reading frame 57
There are no transcripts associated with this gene.
- Gene
- MIR181C
- Gene Name
- microRNA 181c
There are no transcripts associated with this gene.
- Gene
- MIR181D
- Gene Name
- microRNA 181d
There are no transcripts associated with this gene.
- Gene
- NANOS3
- Gene Name
- nanos C2HC-type zinc finger 3
View Full Product Details