Product Details

SNP ID: rs201426734
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49583659 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAGGGAACCTGGAACGGGAGTGTC[G/T]GGAAGAGAGGTGTTCCTGGGAAGAG
Phenotype: MIM: 616759 MIM: 616633 MIM: 604429
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: NOSIP PubMed Links

Gene Details

Gene: NOSIP
Gene Name: nitric oxide synthase interacting protein

There are no transcripts associated with this gene.

Gene: PRR12
Gene Name: proline rich 12

There are no transcripts associated with this gene.

Gene: PRRG2
Gene Name: proline rich and Gla domain 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000951.2	535	Missense Mutation	CGG,CTG	R68L	NP_000942.1
NM_001316335.1	535	Missense Mutation	CGG,CTG	R45L	NP_001303264.1
XM_006723286.2	535	Missense Mutation	CGG,CTG	R68L	XP_006723349.1
XM_011527124.1	535	Missense Mutation	CGG,CTG	R45L	XP_011525426.1

View Full Product Details