Product Details

SNP ID: rs201945831
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:7689402 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATCACGCAGTCCTCGCCCTGGCTCC[A/G]GCTGGTGGGCTCCCCTGGAGCCCAG
Phenotype: MIM: 151445 MIM: 609565
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FCER2 PubMed Links

Gene Details

Gene: FCER2
Gene Name: Fc fragment of IgE receptor II

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001207019.2	838	Missense Mutation			NP_001193948.2
NM_001220500.1	838	Missense Mutation			NP_001207429.1
NM_002002.4	838	Missense Mutation			NP_001993.2
XM_005272462.4	838	Missense Mutation			XP_005272519.1

Gene: MCEMP1
Gene Name: mast cell expressed membrane protein 1

There are no transcripts associated with this gene.

Gene: TRAPPC5
Gene Name: trafficking protein particle complex 5

There are no transcripts associated with this gene.

View Full Product Details