Product Details

SNP ID: rs201137221
Assay Type: Functionally tested
NCBI dbSNP Submissions: 6
Location: Chr.1:52374858 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCCTGATCGACGGAACTCTGCGAG[A/G]ATGGCTCTCAGGAAGCTCTGTTCCA
Phenotype: MIM: 601902
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CC2D1B PubMed Links

Gene Details

Gene: CC2D1B
Gene Name: coiled-coil and C2 domain containing 1B

There are no transcripts associated with this gene.

Gene: ORC1
Gene Name: origin recognition complex subunit 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001190818.1	2466	Silent Mutation	ATC,ATT	I781I	NP_001177747.1
NM_001190819.1	2466	Silent Mutation	ATC,ATT	I776I	NP_001177748.1
NM_004153.3	2466	Silent Mutation	ATC,ATT	I781I	NP_004144.2
XM_011541527.2	2466	Silent Mutation	ATC,ATT	I421I	XP_011539829.1
XM_017001388.1	2466	Silent Mutation	ATC,ATT	I745I	XP_016856877.1
XM_017001389.1	2466	Silent Mutation	ATC,ATT	I535I	XP_016856878.1

Gene: PLA2G12AP1
Gene Name: phospholipase A2 group XIIA pseudogene 1

There are no transcripts associated with this gene.

View Full Product Details