Product Details

SNP ID: rs201618935
Assay Type: Functionally tested
NCBI dbSNP Submissions: 2
Location: Chr.1:1327477 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACCGCGCCCTGCACTGGCTGCAGC[C/T]GTTCCTGGAGGGCCTGCGTACCAGC
Phenotype: MIM: 611354 MIM: 615467 MIM: 601365 MIM: 605865
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CPSF3L PubMed Links

Gene Details

Gene: CPSF3L
Gene Name: cleavage and polyadenylation specific factor 3-like

There are no transcripts associated with this gene.

Gene: CPTP
Gene Name: ceramide-1-phosphate transfer protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001029885.1	774	Missense Mutation	CCG,CTG	P120L	NP_001025056.1
XM_005244801.3	774	Missense Mutation	CCG,CTG	P120L	XP_005244858.1
XM_005244802.1	774	Missense Mutation	CCG,CTG	P57L	XP_005244859.1
XM_011542200.2	774	Missense Mutation	CCG,CTG	P120L	XP_011540502.1

Gene: DVL1
Gene Name: dishevelled segment polarity protein 1

There are no transcripts associated with this gene.

Gene: TAS1R3
Gene Name: taste 1 receptor member 3

There are no transcripts associated with this gene.

View Full Product Details