Product Details

SNP ID: rs201092540
Assay Type: Functionally tested
NCBI dbSNP Submissions: 4
Location: Chr.1:161228446 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTACAGCTGTACACTGGGTAGCTA[C/T]ATTGAATGTGGGATCAGGCGGGGCC
Phenotype: MIM: 107670 MIM: 147139 MIM: 603881
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: APOA2 PubMed Links

Gene Details

Gene: APOA2
Gene Name: apolipoprotein A2

There are no transcripts associated with this gene.

Gene: FCER1G
Gene Name: Fc fragment of IgE receptor Ig

There are no transcripts associated with this gene.

Gene: MIR5187
Gene Name: microRNA 5187

There are no transcripts associated with this gene.

Gene: NR1I3
Gene Name: nuclear receptor subfamily 1 group I member 3

There are no transcripts associated with this gene.

Gene: TOMM40L
Gene Name: translocase of outer mitochondrial membrane 40 like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286373.1	959	Missense Mutation	ACA,ATA	T175I	NP_001273302.1
NM_001286374.1	959	Missense Mutation	ACA,ATA	T144I	NP_001273303.1
NM_032174.5	959	Missense Mutation	ACA,ATA	T209I	NP_115550.2
XM_006711572.2	959	Missense Mutation	ACA,ATA	T209I	XP_006711635.1
XM_011510057.2	959	Missense Mutation	ACA,ATA	T144I	XP_011508359.1
XM_017002481.1	959	Missense Mutation	ACA,ATA	T209I	XP_016857970.1
XM_017002482.1	959	Missense Mutation	ACA,ATA	T175I	XP_016857971.1

View Full Product Details