Product Details

SNP ID: rs199712477
Assay Type: Functionally tested
NCBI dbSNP Submissions: 2
Location: Chr.1:145846638 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTTCGAGAACTTTGGGAGGAGAGTG[G/A]ACTACACCTGCCCCAGGGCCAGTTC
Phenotype: MIM: 605987
Polymorphism: G/A, Transition substitution
Allele Nomenclature
Literature Links: MIR6736 PubMed Links

Gene Details

Gene: MIR6736
Gene Name: microRNA 6736

There are no transcripts associated with this gene.

Gene: NUDT17
Gene Name: nudix hydrolase 17

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001012758.2	1099	Missense Mutation	GAA,GGA	E148G	NP_001012776.1
XM_011509260.2	1099	Missense Mutation	GAA,GGA	E78G	XP_011507562.1
XM_011509262.1	1099	Missense Mutation	GAA,GGA	E148G	XP_011507564.1
XM_017000560.1	1099	Nonsense Mutation	TGA,TGG	*139W	XP_016856049.1

Gene: PIAS3
Gene Name: protein inhibitor of activated STAT 3

There are no transcripts associated with this gene.

Gene: POLR3C
Gene Name: RNA polymerase III subunit C

There are no transcripts associated with this gene.

View Full Product Details