Product Details

SNP ID: rs200200108
Assay Type: Functionally Tested
NCBI dbSNP Submissions: 2
Location: Chr.1:152109181 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGCAGCGGCTGTTCCTCCCTTTCCT[C/G]GAGCAGCTGTTCCTCCTCGCGGAAT
Phenotype: MIM: 190370
Polymorphism: C/G, Transversion Substitution
Allele Nomenclature
Literature Links: TCHH PubMed Links
Additional Information: For this assay, SNP(s) [rs72477383] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_007113.3	4131	Missense Mutation	CAG,GAG	Q1346E	NP_009044.2