Product Details
- SNP ID
-
rs202221419
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.20:62138281 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CGCACTGACTTGGCACCCCGACCTA[C/T]GGCATTGGCCTAAAACAGACACGTA
- Phenotype
-
MIM: 606607
MIM: 606472
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
LSM14B
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs1135961] are located under a probe and SNP(s) [rs7076] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- LSM14B
- Gene Name
- LSM family member 14B
There are no transcripts associated with this gene.
- Gene
- PSMA7
- Gene Name
- proteasome subunit alpha 7
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_002792.3 |
636 |
Missense Mutation |
ATA,GTA |
I161V |
NP_002783.1 |
- Gene
- SS18L1
- Gene Name
- SS18L1, nBAF chromatin remodeling complex subunit
There are no transcripts associated with this gene.
View Full Product Details