Product Details

SNP ID: rs200784759
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:63747047 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATCCTCAGGGGCCAGGCCCTCGTC[A/G]TCCTCGCCCAGCTCCTCCGCCTCCC
Phenotype: MIM: 609809 MIM: 609493 MIM: 614639
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LIME1 PubMed Links

Gene Details

Gene: LIME1
Gene Name: Lck interacting transmembrane adaptor 1

There are no transcripts associated with this gene.

Gene: SLC2A4RG
Gene Name: SLC2A4 regulator

There are no transcripts associated with this gene.

Gene: ZBTB46
Gene Name: zinc finger and BTB domain containing 46

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_025224.3	1934	Silent Mutation	GAC,GAT	D551D	NP_079500.2
XM_005260195.4	1934	Silent Mutation	GAC,GAT	D551D	XP_005260252.1
XM_005260196.3	1934	Silent Mutation	GAC,GAT	D551D	XP_005260253.1
XM_005260197.4	1934	Silent Mutation	GAC,GAT	D551D	XP_005260254.1
XM_005260198.4	1934	Silent Mutation	GAC,GAT	D551D	XP_005260255.1
XM_006723700.3	1934	Silent Mutation	GAC,GAT	D551D	XP_006723763.1
XM_011528548.2	1934	Silent Mutation	GAC,GAT	D551D	XP_011526850.1
XM_011528549.2	1934	Intron			XP_011526851.1
XM_017027667.1	1934	Intron			XP_016883156.1

View Full Product Details