Product Details
- SNP ID
-
rs201526185
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.22:21642364 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GTGGAGCGCGGGCCGCGGCGGGGCT[C/G]CCTGGCCGGTGCTGTTGGGGCTGCT
- Phenotype
-
MIM: 607551
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
CCDC116
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs28436610] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CCDC116
- Gene Name
- coiled-coil domain containing 116
There are no transcripts associated with this gene.
- Gene
- SDF2L1
- Gene Name
- stromal cell derived factor 2 like 1
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_022044.2 |
112 |
Missense Mutation |
CCC,GCC |
P10A |
NP_071327.2 |
View Full Product Details