Product Details

SNP ID: rs201245165
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:219544752 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TATGCCGGGGACTGTGGCAACACTG[C/T]GGTTCCAGCTGCTGCCCCCTGAGCC
Phenotype: MIM: 606715 MIM: 610405 MIM: 610991
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ASIC4 PubMed Links

Gene Details

Gene: ASIC4
Gene Name: acid sensing ion channel subunit family member 4

There are no transcripts associated with this gene.

Gene: CHPF
Gene Name: chondroitin polymerizing factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001195731.1	436	Intron			NP_001182660.1
NM_024536.5	436	Intron			NP_078812.2
XM_011511838.2	436	Intron			XP_011510140.1

Gene: MIR3132
Gene Name: microRNA 3132

There are no transcripts associated with this gene.

Gene: OBSL1
Gene Name: obscurin like 1

There are no transcripts associated with this gene.

Gene: TMEM198
Gene Name: transmembrane protein 198

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001005209.2	436	Missense Mutation	CGG,TGG	R9W	NP_001005209.1
NM_001303098.1	436	Missense Mutation	CGG,TGG	R9W	NP_001290027.1
XM_017003367.1	436	Missense Mutation	CGG,TGG	R9W	XP_016858856.1

View Full Product Details