Product Details

SNP ID: rs201262854
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:27215531 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGCCAACACCTTCCGTGGCTTTAC[G/T]CAGCTCCAGACTCTGTGAGTAAGGG
Phenotype: MIM: 114010 MIM: 604024
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: ATRAID PubMed Links

Gene Details

Gene: ATRAID
Gene Name: all-trans retinoic acid induced differentiation factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001170795.1	689	Silent Mutation	ACG,ACT	T117T	NP_001164266.1
NM_016085.4	689	Silent Mutation	ACG,ACT	T59T	NP_057169.2
NM_080592.3	689	Silent Mutation	ACG,ACT	T172T	NP_542159.3

Gene: CAD
Gene Name: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase

There are no transcripts associated with this gene.

Gene: SLC5A6
Gene Name: solute carrier family 5 member 6

There are no transcripts associated with this gene.

View Full Product Details