Product Details

SNP ID: rs201766809
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:73220745 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGCCCAGGCCCCTCCCAGGATGAC[C/T]CCTTGCATCCTCTCAATAAGCTTCA
Phenotype
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: NOTO PubMed Links

Gene Details

Gene: NOTO
Gene Name: notochord homeobox

There are no transcripts associated with this gene.

Gene: PRADC1
Gene Name: protease associated domain containing 1

There are no transcripts associated with this gene.

Gene: SMYD5
Gene Name: SMYD family member 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006062.2	2179	Missense Mutation	CCC,TCC	P144S	NP_006053.2
XM_006711918.3	2179	Missense Mutation	CCC,TCC	P92S	XP_006711981.1
XM_017003163.1	2179	Missense Mutation	CCC,TCC	P156S	XP_016858652.1

View Full Product Details