Product Details

SNP ID: rs201846830
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:53866876 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTAGCACCCCAGCATGGCGTTTGAC[A/C]AACTCTGCAAAGAGAATAGCAACAT
Phenotype: MIM: 606704 MIM: 607705
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: GPR75 PubMed Links

Gene Details

Gene: GPR75
Gene Name: G protein-coupled receptor 75

There are no transcripts associated with this gene.

Gene: GPR75-ASB3
Gene Name: GPR75-ASB3 readthrough

There are no transcripts associated with this gene.

Gene: PSME4
Gene Name: proteasome activator subunit 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014614.2	5360	Missense Mutation	TTG,TTT	L1756F	NP_055429.2
XM_006711969.1	5360	Missense Mutation	TTG,TTT	L914F	XP_006712032.1
XM_011532705.2	5360	Missense Mutation	TTG,TTT	L1782F	XP_011531007.1
XM_011532706.2	5360	Missense Mutation	TTG,TTT	L1778F	XP_011531008.1
XM_011532707.2	5360	Missense Mutation	TTG,TTT	L1760F	XP_011531009.1
XM_011532709.2	5360	Intron			XP_011531011.1

View Full Product Details