Product Details

SNP ID: rs200566629
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:52249221 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCTGGAGCTACAGGAGGATGATGT[A/G]GTTGTCATGGCAACTGATGGACTCT
Phenotype: MIM: 608979 MIM: 611059
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC101929054 PubMed Links

Gene Details

Gene: LOC101929054
Gene Name: uncharacterized LOC101929054

There are no transcripts associated with this gene.

Gene: PPM1M
Gene Name: protein phosphatase, Mg2+/Mn2+ dependent 1M

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001122870.2	1055	Silent Mutation	GTA,GTG	V166V	NP_001116342.1
NM_144641.3	1055	Silent Mutation	GTA,GTG	V378V	NP_653242.3
XM_005264879.2	1055	Silent Mutation	GTA,GTG	V378V	XP_005264936.1
XM_005264880.3	1055	Silent Mutation	GTA,GTG	V293V	XP_005264937.1
XM_005264881.1	1055	Silent Mutation	GTA,GTG	V217V	XP_005264938.1

Gene: WDR82
Gene Name: WD repeat domain 82

There are no transcripts associated with this gene.

View Full Product Details