Product Details

SNP ID: rs200242644
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:674228 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGGATCACCTTGATGAGCGGAGAG[A/G]CCTGCACCGGTGGCACCATCTTGTC
Phenotype: MIM: 601519 MIM: 160782 MIM: 180072
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ATP5I PubMed Links

Gene Details

Gene: ATP5I
Gene Name: ATP synthase, H+ transporting, mitochondrial Fo complex subunit E

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_007100.3	111	Missense Mutation	GCC,GTC	A7V	NP_009031.1

Gene: MFSD7
Gene Name: major facilitator superfamily domain containing 7

There are no transcripts associated with this gene.

Gene: MYL5
Gene Name: myosin light chain 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002477.1	111	Intron			NP_002468.1
XM_006713886.2	111	Missense Mutation	ACC,GCC	T5A	XP_006713949.1
XM_017008245.1	111	Intron			XP_016863734.1
XM_017008246.1	111	Intron			XP_016863735.1
XM_017008247.1	111	Intron			XP_016863736.1
XM_017008248.1	111	Intron			XP_016863737.1

Gene: PDE6B
Gene Name: phosphodiesterase 6B

There are no transcripts associated with this gene.

View Full Product Details