Product Details

SNP ID: rs201464061
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:176384361 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGTATCTTGATAGTAATTCTTCTCA[C/T]CACGGGCCATGGCCTAAGAGGAGAA
Phenotype: MIM: 118970 MIM: 612861
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ARL10 PubMed Links

Gene Details

Gene: ARL10
Gene Name: ADP ribosylation factor like GTPase 10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001317948.1	795	Intron			NP_001304877.1
NM_173664.5	795	Intron			NP_775935.1
XM_011534529.2	795	Intron			XP_011532831.1
XM_011534530.2	795	Intron			XP_011532832.1
XM_011534531.2	795	Intron			XP_011532833.1
XM_017009372.1	795	Intron			XP_016864861.1

Gene: CLTB
Gene Name: clathrin light chain B

There are no transcripts associated with this gene.

Gene: HIGD2A
Gene Name: HIG1 hypoxia inducible domain family member 2A

There are no transcripts associated with this gene.

Gene: NOP16
Gene Name: NOP16 nucleolar protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256539.3	795	Intron			NP_001243468.2
NM_001256540.3	795	Intron			NP_001243469.2
NM_001291305.2	795	Intron			NP_001278234.1
NM_001291307.2	795	Intron			NP_001278236.1
NM_001291308.2	795	Intron			NP_001278237.1
NM_001317975.1	795	Missense Mutation	GAT,GGT	D131G	NP_001304904.1
NM_016391.7	795	Missense Mutation	GAT,GGT	D136G	NP_057475.2
XM_011534567.1	795	UTR 3			XP_011532869.1

View Full Product Details