Product Details

SNP ID: rs201371274
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:30062321 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAAGGGCAAACTGTCTTCTACACCT[A/G]TACCAACTGCAAGTGAGTATTCTTT
Phenotype: MIM: 606670 MIM: 607524 MIM: 607525 MIM: 615714
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: PPP1R11 PubMed Links

Gene Details

Gene: PPP1R11
Gene Name: protein phosphatase 1 regulatory inhibitor subunit 11

There are no transcripts associated with this gene.

Gene: RNF39
Gene Name: ring finger protein 39

There are no transcripts associated with this gene.

Gene: ZNRD1
Gene Name: zinc ribbon domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278785.1	513	Missense Mutation	TAT,TGT	Y115C	NP_001265714.1
NM_001278786.1	513	Missense Mutation	TAT,TGT	Y115C	NP_001265715.1
NM_014596.5	513	Missense Mutation	TAT,TGT	Y115C	NP_055411.1
NM_170783.3	513	Missense Mutation	TAT,TGT	Y115C	NP_740753.1

Gene: ZNRD1ASP
Gene Name: zinc ribbon domain containing 1 antisense, pseudogene

There are no transcripts associated with this gene.

View Full Product Details