Product Details

SNP ID: rs199908448
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:101164409 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGGAGGGATCGCTCGCCTCGGGCCC[A/G]TTCTCCGGAGTCTGAGGGCGAGGCG
Phenotype: MIM: 603531 MIM: 615783 MIM: 602186
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AP1S1 PubMed Links

Gene Details

Gene: AP1S1
Gene Name: adaptor related protein complex 1 sigma 1 subunit

There are no transcripts associated with this gene.

Gene: MIR4653
Gene Name: microRNA 4653

There are no transcripts associated with this gene.

Gene: NAT16
Gene Name: N-acetyltransferase 16 (putative)

There are no transcripts associated with this gene.

Gene: VGF
Gene Name: VGF nerve growth factor inducible

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003378.3	653	Silent Mutation	AAC,AAT	N145N	NP_003369.2
XM_005250561.4	653	Silent Mutation	AAC,AAT	N145N	XP_005250618.1
XM_011516549.2	653	Silent Mutation	AAC,AAT	N145N	XP_011514851.1
XM_017012579.1	653	Silent Mutation	AAC,AAT	N145N	XP_016868068.1

View Full Product Details