Product Details

SNP ID: rs201506127
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:150330644 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGCTGGCCACCTTGCTGGACCCTTG[C/G]TTCAAGGGGAAGATTGAGGCCATCC
Phenotype: MIM: 601973 MIM: 615252
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ACTR3C PubMed Links

Gene Details

Gene: ACTR3C
Gene Name: ARP3 actin-related protein 3 homolog C

There are no transcripts associated with this gene.

Gene: LRRC61
Gene Name: leucine rich repeat containing 61

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142928.1	796	Intron			NP_001136400.1
NM_023942.2	796	Intron			NP_076431.1
XM_006716095.2	796	Intron			XP_006716158.1

Gene: RARRES2
Gene Name: retinoic acid receptor responder 2

There are no transcripts associated with this gene.

Gene: ZBED6CL
Gene Name: ZBED6 C-terminal like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_138434.2	796	Silent Mutation	TGC,TGG	C80W	NP_612443.1

View Full Product Details