Product Details

SNP ID: rs200847005
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:128721398 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGGTAGAGGTGCGAGACGAGGAGC[A/G]GGCTGGCCACCAACGAGAAGAGGGA
Phenotype: MIM: 610714
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC100506100 PubMed Links

Gene Details

Gene: LOC100506100
Gene Name: uncharacterized LOC100506100

There are no transcripts associated with this gene.

Gene: PKN3
Gene Name: protein kinase N3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001317926.1	775	Intron			NP_001304855.1
NM_013355.4	775	Intron			NP_037487.2
XM_005251946.3	775	Intron			XP_005252003.1
XM_006717080.2	775	Intron			XP_006717143.1
XM_017014649.1	775	Intron			XP_016870138.1
XM_017014650.1	775	Intron			XP_016870139.1

Gene: ZDHHC12
Gene Name: zinc finger DHHC-type containing 12

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318015.1	775	Missense Mutation	CCG,CTG	P251L	NP_001304944.1
NM_001318016.1	775	Silent Mutation	CCC,CCT	P205P	NP_001304945.1
NM_001318020.1	775	Missense Mutation	CGC,TGC	R189C	NP_001304949.1
NM_001318023.1	775	Missense Mutation	CCG,CTG	P195L	NP_001304952.1
NM_032799.4	775	Missense Mutation	CCG,CTG	P196L	NP_116188.2
XM_011519116.2	775	Missense Mutation	CGC,TGC	R244C	XP_011517418.1

Gene: ZER1
Gene Name: zyg-11 related cell cycle regulator

There are no transcripts associated with this gene.

View Full Product Details