Product Details

SNP ID: rs13369
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:1272838 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GTGCCCCACTCACTTCTCTGAGATC[A/G]AACGGACTGTGAATCCGCTCTTTGT
Phenotype: MIM: 602649 MIM: 602756
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C19orf24 PubMed Links

Gene Details

Gene: C19orf24
Gene Name: chromosome 19 open reading frame 24

There are no transcripts associated with this gene.

Gene: CIRBP
Gene Name: cold inducible RNA binding protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001280.2	1440	UTR 3			NP_001271.1
NM_001300815.1	1440	Intron			NP_001287744.1
NM_001300829.1	1440	UTR 3			NP_001287758.1
XM_006722637.1	1440	UTR 3			XP_006722700.1
XM_011527668.1	1440	Intron			XP_011525970.1
XM_017026237.1	1440	Intron			XP_016881726.1

Gene: CIRBP-AS1
Gene Name: CIRBP antisense RNA 1

There are no transcripts associated with this gene.

Gene: EFNA2
Gene Name: ephrin A2

There are no transcripts associated with this gene.

View Full Product Details