Product Details

SNP ID: rs11587982
Assay Type: Validated
NCBI dbSNP Submissions: 26
Location: Chr.1:45696196 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: AAAATGCTATTTTTCCAGGTGAATT[A/T]CAGTGTATGCTTCTTTAAGAAAACT
Phenotype: MIM: 147485
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: GPBP1L1 PubMed Links

Gene Details

Gene: GPBP1L1
Gene Name: GC-rich promoter binding protein 1 like 1

There are no transcripts associated with this gene.

Gene: IPP
Gene Name: intracisternal A particle-promoted polypeptide

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145349.1	5571	Intron			NP_001138821.1
NM_005897.2	5571	Intron			NP_005888.1
XM_005270839.4	5571	UTR 3			XP_005270896.1
XM_006710623.3	5571	UTR 3			XP_006710686.1
XM_011541394.2	5571	Intron			XP_011539696.1
XM_017001210.1	5571	Intron			XP_016856699.1

Gene: TMEM69
Gene Name: transmembrane protein 69

There are no transcripts associated with this gene.

View Full Product Details