Product Details

SNP ID: rs9915183
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:54969776 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATTTATTTATTGCCCTCTCAACTGT[A/G]GGCCTGACACCAATCGACCTGCTGG
Phenotype: MIM: 603648 MIM: 610415 MIM: 604701
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: COX11 PubMed Links

Gene Details

Gene: COX11
Gene Name: COX11, cytochrome c oxidase copper chaperone

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001162861.2	1249	Intron			NP_001156333.1
NM_001162862.2	1249	Intron			NP_001156334.1
NM_001321518.1	1249	Intron			NP_001308447.1
NM_004375.4	1249	Intron			NP_004366.1
XM_011524342.2	1249	UTR 5			XP_011522644.1
XM_017024192.1	1249	UTR 5			XP_016879681.1
XM_017024193.1	1249	Intron			XP_016879682.1
XM_017024194.1	1249	Intron			XP_016879683.1
XM_017024195.1	1249	Intron			XP_016879684.1
XM_017024196.1	1249	Intron			XP_016879685.1

Gene: STXBP4
Gene Name: syntaxin binding protein 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_178509.5	1249	Intron			NP_848604.3
XM_005257187.4	1249	Intron			XP_005257244.1
XM_006721797.3	1249	Intron			XP_006721860.1
XM_006721798.3	1249	Intron			XP_006721861.1
XM_017024410.1	1249	Intron			XP_016879899.1
XM_017024411.1	1249	Intron			XP_016879900.1
XM_017024412.1	1249	Intron			XP_016879901.1
XM_017024413.1	1249	Intron			XP_016879902.1
XM_017024414.1	1249	Intron			XP_016879903.1
XM_017024415.1	1249	Intron			XP_016879904.1

Gene: TOM1L1
Gene Name: target of myb1 like 1 membrane trafficking protein

There are no transcripts associated with this gene.

View Full Product Details