Product Details
- SNP ID
-
rs6450
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.6:32039020 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TCTGGTGGGGAGAAAGCAGGGGTTG[A/G]GGAGGCCGAAGAAGGTCAGGCCCTC
- Phenotype
-
MIM: 120820
MIM: 613815
MIM: 600985
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
C4B
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs79249676] are located under a probe and SNP(s) [rs578235636] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- C4B
- Gene Name
- complement component 4B (Chido blood group)
There are no transcripts associated with this gene.
- Gene
- CYP21A2
- Gene Name
- cytochrome P450 family 21 subfamily A member 2
- Gene
- TNXB
- Gene Name
- tenascin XB
There are no transcripts associated with this gene.
View Full Product Details