Product Details

SNP ID

rs1052362

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.14:21016803 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TCCTCTACAGTTTATTGTTATAGCA[A/G]AAGTTGTGGGAGACGGGAGGGCACC

Phenotype

MIM: 605272 MIM: 616956

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

MIR6717 PubMed Links

Gene Details

Gene

MIR6717

Gene Name

microRNA 6717

There are no transcripts associated with this gene.

Gene

NDRG2

Gene Name

NDRG family member 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282211.1	2171	UTR 3			NP_001269140.1
NM_001282212.1	2171	UTR 3			NP_001269141.1
NM_001282213.1	2171	UTR 3			NP_001269142.1
NM_001282214.1	2171	UTR 3			NP_001269143.1
NM_001282215.1	2171	UTR 3			NP_001269144.1
NM_001282216.1	2171	UTR 3			NP_001269145.1
NM_001320329.1	2171	UTR 3			NP_001307258.1
NM_016250.2	2171	UTR 3			NP_057334.1
NM_201535.1	2171	UTR 3			NP_963293.1
NM_201536.1	2171	UTR 3			NP_963294.1
NM_201537.1	2171	UTR 3			NP_963831.1
NM_201538.1	2171	UTR 3			NP_963832.1
NM_201539.1	2171	UTR 3			NP_963833.1
NM_201540.1	2171	UTR 3			NP_963834.1
NM_201541.1	2171	UTR 3			NP_963835.1
XM_011536996.2	2171	UTR 3			XP_011535298.1
XM_011536997.1	2171	UTR 3			XP_011535299.1
XM_011536998.1	2171	UTR 3			XP_011535300.1
XM_011536999.1	2171	UTR 3			XP_011535301.1
XM_011537001.1	2171	UTR 3			XP_011535303.1
XM_011537002.1	2171	UTR 3			XP_011535304.1
XM_017021480.1	2171	UTR 3			XP_016876969.1
XM_017021481.1	2171	UTR 3			XP_016876970.1
XM_017021482.1	2171	UTR 3			XP_016876971.1
XM_017021483.1	2171	UTR 3			XP_016876972.1
XM_017021484.1	2171	UTR 3			XP_016876973.1
XM_017021485.1	2171	UTR 3			XP_016876974.1
XM_017021486.1	2171	UTR 3			XP_016876975.1
XM_017021487.1	2171	UTR 3			XP_016876976.1
XM_017021488.1	2171	UTR 3			XP_016876977.1
XM_017021489.1	2171	UTR 3			XP_016876978.1
XM_017021490.1	2171	UTR 3			XP_016876979.1
XM_017021491.1	2171	UTR 3			XP_016876980.1
XM_017021492.1	2171	UTR 3			XP_016876981.1
XM_017021493.1	2171	UTR 3			XP_016876982.1
XM_017021494.1	2171	UTR 3			XP_016876983.1
XM_017021495.1	2171	UTR 3			XP_016876984.1
XM_017021496.1	2171	UTR 3			XP_016876985.1
XM_017021497.1	2171	UTR 3			XP_016876986.1

Gene

TPPP2

Gene Name

tubulin polymerization promoting protein family member 2

There are no transcripts associated with this gene.

View Full Product Details