Product Details

SNP ID: rs2277693
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:47831817 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGACCCTTCACATCAATTTACTGTT[G/T]TCTTCGACCTCACCCCAGCAATTTT
Phenotype: MIM: 611825 MIM: 606735 MIM: 614966
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: LRRC46 PubMed Links

Gene Details

Gene: LRRC46
Gene Name: leucine rich repeat containing 46

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_033413.3	191	UTR 5			NP_219481.1
XM_005257775.4	191	Intron			XP_005257832.1

Gene: MRPL10
Gene Name: mitochondrial ribosomal protein L10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_145255.3	191	Intron			NP_660298.2
NM_148887.2	191	Intron			NP_683685.1

Gene: OSBPL7
Gene Name: oxysterol binding protein like 7

There are no transcripts associated with this gene.

Gene: SCRN2
Gene Name: secernin 2

There are no transcripts associated with this gene.

View Full Product Details