Product Details

SNP ID

rs2243876

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.2:189752917 on Build GRCh38

Set Membership

HapMap

Context Sequence [VIC/FAM]

GACACAACAAAGTGCACTGTGTTGC[A/G]TTTGTTAAAATTTCCAGAGCTCTGC

Phenotype

MIM: 609803

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

ANKAR PubMed Links

Gene Details

Gene

ANKAR

Gene Name

ankyrin and armadillo repeat containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_144708.3	1143	Intron			NP_653309.3
XM_011510673.2	1143	Intron			XP_011508975.1
XM_011510674.1	1143	Intron			XP_011508976.1
XM_011510675.2	1143	Intron			XP_011508977.1
XM_011510676.2	1143	Intron			XP_011508978.1
XM_011510677.2	1143	Intron			XP_011508979.1
XM_011510679.2	1143	Intron			XP_011508981.1
XM_011510680.1	1143	Intron			XP_011508982.1
XM_011510681.1	1143	Intron			XP_011508983.1
XM_011510682.2	1143	Intron			XP_011508984.1
XM_011510685.2	1143	Intron			XP_011508987.1
XM_011510686.2	1143	Intron			XP_011508988.1
XM_011510687.2	1143	Intron			XP_011508989.1
XM_011510688.1	1143	Intron			XP_011508990.1
XM_011510689.2	1143	Intron			XP_011508991.1
XM_011510691.2	1143	Intron			XP_011508993.1
XM_011510692.2	1143	Intron			XP_011508994.1
XM_011510693.2	1143	Intron			XP_011508995.1
XM_011510694.2	1143	Intron			XP_011508996.1
XM_017003413.1	1143	Intron			XP_016858902.1
XM_017003414.1	1143	Intron			XP_016858903.1
XM_017003415.1	1143	Intron			XP_016858904.1
XM_017003416.1	1143	Intron			XP_016858905.1
XM_017003417.1	1143	Intron			XP_016858906.1
XM_017003418.1	1143	Intron			XP_016858907.1
XM_017003419.1	1143	Intron			XP_016858908.1
XM_017003420.1	1143	Intron			XP_016858909.1

Gene

OSGEPL1

Gene Name

O-sialoglycoprotein endopeptidase-like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022353.2	1143	Silent Mutation	AAC,AAT	N342N	NP_071748.2
XM_005246766.3	1143	Silent Mutation	AAC,AAT	N342N	XP_005246823.1
XM_006712685.1	1143	Silent Mutation	AAC,AAT	N342N	XP_006712748.1
XM_006712686.1	1143	Silent Mutation	AAC,AAT	N195N	XP_006712749.1
XM_011511631.1	1143	Silent Mutation	AAC,AAT	N342N	XP_011509933.1
XM_017004676.1	1143	Silent Mutation	AAC,AAT	N342N	XP_016860165.1
XM_017004677.1	1143	Silent Mutation	AAC,AAT	N342N	XP_016860166.1
XM_017004678.1	1143	Silent Mutation	AAC,AAT	N342N	XP_016860167.1
XM_017004679.1	1143	Silent Mutation	AAC,AAT	N342N	XP_016860168.1
XM_017004680.1	1143	Silent Mutation	AAC,AAT	N342N	XP_016860169.1
XM_017004681.1	1143	Silent Mutation	AAC,AAT	N195N	XP_016860170.1
XM_017004682.1	1143	Silent Mutation	AAC,AAT	N195N	XP_016860171.1
XM_017004683.1	1143	Silent Mutation	AAC,AAT	N195N	XP_016860172.1
XM_017004684.1	1143	Silent Mutation	AAC,AAT	N195N	XP_016860173.1
XM_017004685.1	1143	Silent Mutation	AAC,AAT	N195N	XP_016860174.1

Gene

OSGEPL1-AS1

Gene Name

OSGEPL1 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details