Product Details

SNP ID: rs2075473
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.19:36111548 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: CCATCTGCACACGCCCTCCAGCCTC[A/G]GGACCTGTCCGCCCCTACTTCTCTG
Phenotype: MIM: 616442 MIM: 180662 MIM: 601303 MIM: 613583
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: OVOL3 PubMed Links

Gene Details

Gene: OVOL3
Gene Name: ovo like zinc finger 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001302757.1		Intron			NP_001289686.1
XM_011527251.2		Intron			XP_011525553.1
XM_017027190.1		Intron			XP_016882679.1
XM_017027191.1		Intron			XP_016882680.1

Gene: POLR2I
Gene Name: RNA polymerase II subunit I

There are no transcripts associated with this gene.

Gene: TBCB
Gene Name: tubulin folding cofactor B

There are no transcripts associated with this gene.

Gene: WDR62
Gene Name: WD repeat domain 62

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001083961.1		Intron			NP_001077430.1
NM_173636.4		Intron			NP_775907.4
XM_005258809.2		Intron			XP_005258866.1
XM_011526837.1		Intron			XP_011525139.1
XM_011526838.1		Intron			XP_011525140.1
XM_011526839.1		Intron			XP_011525141.1
XM_011526840.2		Intron			XP_011525142.1
XM_011526841.2		Intron			XP_011525143.1
XM_011526842.1		Intron			XP_011525144.1
XM_011526843.1		Intron			XP_011525145.1
XM_011526844.2		Intron			XP_011525146.1
XM_017026665.1		Intron			XP_016882154.1

View Full Product Details