Product Details

SNP ID: rs2306242
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.4:849932 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGCCAGCACCGCGCGGCGATAGTGC[C/T]TCTTCACTTGCTCCGGAGCCACCAG
Phenotype: MIM: 602052
Polymorphism: C/T, Transition Substitution
Allele Nomenclature
Literature Links: GAK PubMed Links
Additional Information: For this assay, SNP(s) [rs55728587] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318134.1	4069	Missense Mutation	AAG,AGG	K1186R	NP_001305063.1
NM_005255.3	4069	Missense Mutation	AAG,AGG	K1265R	NP_005246.2
XM_005272268.2	4069	Missense Mutation	AAG,AGG	K1254R	XP_005272325.1
XM_005272270.2	4069	Missense Mutation	AAG,AGG	K1190R	XP_005272327.1
XM_011513425.2	4069	Missense Mutation	AAG,AGG	K1309R	XP_011511727.1
XM_011513426.2	4069	Missense Mutation	AAG,AGG	K1298R	XP_011511728.1
XM_011513427.2	4069	Missense Mutation	AAG,AGG	K1279R	XP_011511729.1
XM_011513428.2	4069	Missense Mutation	AAG,AGG	K1260R	XP_011511730.1
XM_011513429.2	4069	Missense Mutation	AAG,AGG	K1247R	XP_011511731.1
XM_011513430.1	4069	Missense Mutation	AAG,AGG	K1230R	XP_011511732.1
XM_011513431.2	4069	Missense Mutation	AAG,AGG	K1226R	XP_011511733.1
XM_011513432.2	4069	Missense Mutation	AAG,AGG	K1221R	XP_011511734.1
XM_011513434.2	4069	Missense Mutation	AAG,AGG	K1173R	XP_011511736.1
XM_017007991.1	4069	Missense Mutation	AAG,AGG	K1235R	XP_016863480.1
XM_017007992.1	4069	Missense Mutation	AAG,AGG	K1200R	XP_016863481.1
XM_017007993.1	4069	Missense Mutation	AAG,AGG	K1173R	XP_016863482.1
XM_017007994.1	4069	Intron			XP_016863483.1
XM_017007995.1	4069	Missense Mutation	AAG,AGG	K1085R	XP_016863484.1