Product Details

SNP ID: rs2738300
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.12:10590990 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AACATATGAGATGTTAGATATAGAT[A/T]CGTAAGTAAAGTATGTGAGCACCGA
Phenotype: MIM: 604274
Polymorphism: A/T, Transversion Substitution
Allele Nomenclature
Literature Links: KLRA1P PubMed Links
Additional Information: For this assay, SNP(s) [rs75667057] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

There are no transcripts associated with this gene.