Product Details

SNP ID: rs28372928
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:69339948 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGGTGGCCAAGGGTGGAGTGGGGG[C/T]GCGGTGCCGGAGACCGGTTCGTTCG
Phenotype: MIM: 606979
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: COG8 PubMed Links

Gene Details

Gene: COG8
Gene Name: component of oligomeric golgi complex 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032382.4		Intron			NP_115758.3

Gene: NIP7
Gene Name: NIP7, nucleolar pre-rRNA processing protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199434.1		Intron			NP_001186363.1
NM_016101.4		Intron			NP_057185.1

Gene: PDF
Gene Name: peptide deformylase (mitochondrial)

There are no transcripts associated with this gene.

Gene: TMED6
Gene Name: transmembrane p24 trafficking protein 6

There are no transcripts associated with this gene.

View Full Product Details