Product Details

SNP ID: rs3134945
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:32178715 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCTTATATACTGGAGAGGCTAGGAG[A/C]GAATAATCATACAGTCATACAGATA
Phenotype: MIM: 600214 MIM: 603099 MIM: 176311 MIM: 602677
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: AGER PubMed Links

Gene Details

Gene: AGER
Gene Name: advanced glycosylation end product-specific receptor

There are no transcripts associated with this gene.

Gene: AGPAT1
Gene Name: 1-acylglycerol-3-phosphate O-acyltransferase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006411.3		Intron			NP_006402.1
NM_032741.4		Intron			NP_116130.2
XM_005248805.3		Intron			XP_005248862.1
XM_005248806.2		Intron			XP_005248863.1
XM_011514234.1		Intron			XP_011512536.1

Gene: MIR6721
Gene Name: microRNA 6721

There are no transcripts associated with this gene.

Gene: MIR6833
Gene Name: microRNA 6833

There are no transcripts associated with this gene.

Gene: PBX2
Gene Name: PBX homeobox 2

There are no transcripts associated with this gene.

Gene: RNF5
Gene Name: ring finger protein 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006913.3		Intron			NP_008844.1

View Full Product Details