Product Details

SNP ID: rs35045265
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:65641160 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCCACAGCCACGAAGAGGCCAGCC[G/A]ACCTGCAGCCACTTCCACCCGGCTC
Phenotype: MIM: 602180
Polymorphism: G/A, Transition substitution
Allele Nomenclature
Literature Links: MIR4489 PubMed Links

Gene Details

Gene: MIR4489
Gene Name: microRNA 4489

There are no transcripts associated with this gene.

Gene: MIR4690
Gene Name: microRNA 4690

There are no transcripts associated with this gene.

Gene: PCNX3
Gene Name: pecanex homolog 3 (Drosophila)

There are no transcripts associated with this gene.

Gene: SIPA1
Gene Name: signal-induced proliferation-associated 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006747.3	446	Missense Mutation	CAA,CGA	Q80R	NP_006738.3
NM_153253.29	446	Missense Mutation	CAA,CGA	Q80R	NP_694985.29
XM_005274189.2	446	Missense Mutation	CAA,CGA	Q80R	XP_005274246.1
XM_011545214.1	446	Missense Mutation	CAA,CGA	Q80R	XP_011543516.1

View Full Product Details