Product Details

SNP ID: rs34895002
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:67675359 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGGTGCGGCGGTCGCCCTGCCCCTG[A/G]AAGGACTGGCGCAAGGCCTGCACCA
Phenotype
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C16orf86 PubMed Links

Gene Details

Gene: C16orf86
Gene Name: chromosome 16 open reading frame 86

There are no transcripts associated with this gene.

Gene: ENKD1
Gene Name: enkurin domain containing 1

There are no transcripts associated with this gene.

Gene: GFOD2
Gene Name: glucose-fructose oxidoreductase domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001243650.1	992	Intron			NP_001230579.1
NM_030819.3	992	Silent Mutation	TTC,TTT	F318F	NP_110446.3
XM_006721288.3	992	Silent Mutation	TTC,TTT	F213F	XP_006721351.1
XM_017023738.1	992	Silent Mutation	TTC,TTT	F318F	XP_016879227.1

View Full Product Details