Product Details

SNP ID: rs34521609
Assay Type: Functionally tested
NCBI dbSNP Submissions: 35
Location: Chr.1:52373320 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGAACACACGGCCATGGTCTCTGAC[A/G]TGGTGGGGTACGGCAGTCCCTCCAT
Phenotype: MIM: 601902
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CC2D1B PubMed Links

Gene Details

Gene: CC2D1B
Gene Name: coiled-coil and C2 domain containing 1B

There are no transcripts associated with this gene.

Gene: ORC1
Gene Name: origin recognition complex subunit 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001190818.1	2570	Missense Mutation	ACG,ATG	T816M	NP_001177747.1
NM_001190819.1	2570	Missense Mutation	ACG,ATG	T811M	NP_001177748.1
NM_004153.3	2570	Missense Mutation	ACG,ATG	T816M	NP_004144.2
XM_011541527.2	2570	Missense Mutation	ACG,ATG	T456M	XP_011539829.1
XM_017001388.1	2570	Missense Mutation	ACG,ATG	T780M	XP_016856877.1
XM_017001389.1	2570	Missense Mutation	ACG,ATG	T570M	XP_016856878.1

Gene: PLA2G12AP1
Gene Name: phospholipase A2 group XIIA pseudogene 1

There are no transcripts associated with this gene.

View Full Product Details