Product Details
- SNP ID
-
rs9282628
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.21:36135442 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTTCCTGCGCAAGGAGTACGGGGGG[C/G]TCAACGTACTGGTCAACAACGCGGC
- Phenotype
-
MIM: 603608
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
CBR3
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs881711] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CBR3
- Gene Name
- carbonyl reductase 3
- Gene
- CBR3-AS1
- Gene Name
- CBR3 antisense RNA 1
There are no transcripts associated with this gene.
- Gene
- LOC100133286
- Gene Name
- uncharacterized LOC100133286
There are no transcripts associated with this gene.
View Full Product Details