Product Details

SNP ID: rs145402970
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:48628420 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGCAGGAGATGGGGGTCACCAGAC[A/G]AAAGGGGCCCTGCCTGTTTCCGAAG
Phenotype: MIM: 604264 MIM: 610068
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CELSR3 PubMed Links

Gene Details

Gene: CELSR3
Gene Name: cadherin EGF LAG seven-pass G-type receptor 3

There are no transcripts associated with this gene.

Gene: MIR6824
Gene Name: microRNA 6824

There are no transcripts associated with this gene.

Gene: SLC26A6
Gene Name: solute carrier family 26 member 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040454.1	1914	Intron			NP_001035544.1
NM_001281732.1	1914	Intron			NP_001268661.1
NM_001281733.1	1914	Intron			NP_001268662.1
NM_022911.2	1914	Intron			NP_075062.2
NM_134263.2	1914	Intron			NP_599025.2
NM_134426.2	1914	Missense Mutation	TCG,TTG	S605L	NP_602298.2

Gene: TMEM89
Gene Name: transmembrane protein 89

There are no transcripts associated with this gene.

View Full Product Details