Product Details

SNP ID: rs4149804
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:2973007 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGCTGAGGAGGTTCCGAGGCTCAAA[A/G]GAGGGGAAGGAGCCCCGAGGAGGCT
Phenotype: MIM: 609899 MIM: 614578 MIM: 602474
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: KREMEN2 PubMed Links

Gene Details

Gene: KREMEN2
Gene Name: kringle containing transmembrane protein 2

There are no transcripts associated with this gene.

Gene: PAQR4
Gene Name: progestin and adipoQ receptor family member 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284511.1	2110	UTR 3			NP_001271440.1
NM_001284512.1	2110	UTR 3			NP_001271441.1
NM_001284513.1	2110	UTR 3			NP_001271442.1
NM_001324118.1	2110	UTR 3			NP_001311047.1
NM_152341.4	2110	UTR 3			NP_689554.2

Gene: PKMYT1
Gene Name: protein kinase, membrane associated tyrosine/threonine 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001258450.1	2110	Silent Mutation	TCC,TCT	S413S	NP_001245379.1
NM_001258451.1	2110	Silent Mutation	TCC,TCT	S473S	NP_001245380.1
NM_004203.4	2110	Silent Mutation	TCC,TCT	S482S	NP_004194.3
NM_182687.2	2110	UTR 3			NP_872629.1
XM_011522734.2	2110	Silent Mutation	TCC,TCT	S482S	XP_011521036.1
XM_011522735.2	2110	Silent Mutation	TCC,TCT	S473S	XP_011521037.1
XM_011522736.2	2110	Silent Mutation	TCC,TCT	S473S	XP_011521038.1

View Full Product Details