Product Details

SNP ID
rs61737308
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.15:77614797 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
ACAGGAGCCGACAGTCGCAGGCCAG[C/T]GGGTTGGAGTCCAGGATGAGTGTCT
Phenotype
MIM: 609791
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
LINGO1 PubMed Links
Additional Information
For this assay, SNP(s) [rs3743481] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
LINGO1
Gene Name
leucine rich repeat and Ig domain containing 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001301186.1 1304 Silent Mutation CCC,CCT P364P NP_001288115.1
NM_001301187.1 1304 Silent Mutation CCC,CCT P364P NP_001288116.1
NM_001301189.1 1304 Silent Mutation CCC,CCT P364P NP_001288118.1
NM_001301191.1 1304 Silent Mutation CCC,CCT P364P NP_001288120.1
NM_001301192.1 1304 Silent Mutation CCC,CCT P364P NP_001288121.1
NM_001301194.1 1304 Silent Mutation CCC,CCT P364P NP_001288123.1
NM_001301195.1 1304 Silent Mutation CCC,CCT P364P NP_001288124.1
NM_001301197.1 1304 Silent Mutation CCC,CCT P364P NP_001288126.1
NM_001301198.1 1304 Silent Mutation CCC,CCT P364P NP_001288127.1
NM_001301199.1 1304 Silent Mutation CCC,CCT P364P NP_001288128.1
NM_001301200.1 1304 Silent Mutation CCC,CCT P364P NP_001288129.1
NM_032808.6 1304 Silent Mutation CCC,CCT P370P NP_116197.4
XM_011522118.2 1304 Silent Mutation XP_011520420.1
XM_017022682.1 1304 Silent Mutation XP_016878171.1

View Full Product Details