Product Details

SNP ID: rs7202874
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:89198052 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGCTGCTCCCCTGTCGGCACTATGG[C/T]CCCCTGGTGTGGCAGACCGTCGGCC
Phenotype: MIM: 114019
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CDH15 PubMed Links

Gene Details

Gene: CDH15
Gene Name: cadherin 15

There are no transcripts associated with this gene.

Gene: SLC22A31
Gene Name: solute carrier family 22 member 31

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242757.1		Intron			NP_001229686.1
XM_011522897.2		Intron			XP_011521199.1
XM_011522899.2		Intron			XP_011521201.1
XM_017022962.1		Intron			XP_016878451.1
XM_017022963.1		Intron			XP_016878452.1
XM_017022964.1		Intron			XP_016878453.1
XM_017022965.1		Intron			XP_016878454.1
XM_017022966.1		Intron			XP_016878455.1

Gene: ZNF778
Gene Name: zinc finger protein 778

There are no transcripts associated with this gene.

View Full Product Details